About   Help   FAQ
MTF#540 Probe Detail
Nucleotide
Probe/Clone
  • Name
    MTF#540
  • Sequence Type
    cDNA
  • ID
    MGI:3506258
  • Region Covered
    Nucleotides 331-1110 of GenBank Accession ID U81983.
  • Vector Type
    Plasmid
  • Insert Site
    XbaI/XhoI
  • Insert Size
    0.779kb
  • Note
    The source of the material used to create this cDNA probe was different than that used to create the GenBank sequence record. Fragment was generated by PCR with primers TCGTCTAGAGAATCTGAAGCTGAGGCCGACC and CCGCTCGAGACACTGAGGCTGCAGGTTGCGG. Template sequence provided by Paul Gray:
    GNTCGAGCGGCCGCCAGTGTGATGGATATCTGCAGAATTCGGCTTCCGCTCGAGACACTG
    AGGCTGCAGGTTGCGGGGGTTGTAGATGACCGTCCCCTGGGTCTCCAGCCACACATATCC
    TCCGTGTTTGGCTAGCATCCGGTACTGGCCAGATACCACCTGCCCCTTGGTGCACAAGTT
    CTGGTGACTTTTGGTCATGTTCTCCGAATCCAGGGCATGGTAGAACTCATAGGCAGAGCG
    TCCAAGTAGCTCCTCGGGGTGGTAACCAATCAGTTCCAAGATTCTGTCGTCACAGTAGGT
    GAACTTCATGTCCATGCTGTGGCGGCTCAGGAAAGTCTTGCTGTCCAGGGGGATGTCCAT
    GTGGGATGGGTGCTGGATTGGCTCACACATGATGATAAGGCAGGACAGCAGGGGCTCCTT
    GGAGCCACAGAGGCTACTGTGAGGGGGGCAGTTGTTGTAGACTCTCACTTGCCCGGTGCA
    GTGCAGGACCTTCCAGGTGGCCGACTTGAGGTTGACAGTCCGGCCTCTGTTGGTGACCGT
    GCACTTCATCCTCATGAAGAAGTCACGCTCGGTGGACACGTCTTTGCTCTTCTTCCCAAA
    ACCAGAGCCGTTTTTGAGAGTCAGGTTCTCACGGATCTCCTCATGGTCGCAAGGATGAGT
    GAAGTCAAAGATGCTGTGTCCTGTTAGTTCTACCTGAGTAAGTCCCATGAACTTGCTGAT
    GTTTTCCGACAGAAAGATCATGTCACCGTCTTGGGTCACCACAGCAATGAANCCTCCAAG
    GCTTTCAGGTACAAGTTATCCATTTTGCTGGTCGGCCTCAGCTTCAGATTCTCTAGACGA
    AAGCCGAATTCCAGCACACTGGCGGNCGNTTACTAGTGGATCCCANCTCGGTACCNAGCT
    TGATGCATAGCTTGAGTATTCTTTANNGCCCCCAAATANCTTGGNNTATNATGGGCANAA
    NCTNTTTCCGGGGGNAAATGTTATCCNCCCCAANTTCCCCCAAANANNAGNCGGNAANNT
    AAATGGTNAANC
  • Synonyms
    GUDMAP:5573 probe, GUDMAP:7216 probe, GUDMAP:12243 probe, GUDMAP:12580 probe, GUDMAP:12581 probe, maprobe:293
Source
  • Species
    mouse, laboratory
  • Strain
    C57BL
  • Age
    embryonic day 13.5
  • Tissue
    brain
Genes
Epas1 endothelial PAS domain protein 1
Expression
  • Assay Results
    75
Sequences
References
J:91257 Gray PA, et al., Mouse Brain Organization Revealed Through Direct Genome-Scale TF Expression Analysis. Science. 2004 Dec 24;306(5705):2255-2257
J:171409 GUDMAP Consortium, GUDMAP: the GenitoUrinary Development Molecular Anatomy Project. www.gudmap.org. 2004;
J:168654 Chung YC, et al., Screening large numbers of expression patterns of transcription factors in late stages of the mouse thymus. Gene Expr Patterns. 2011 Jan-Feb;11(1-2):84-92
J:190636 Wiese CB, et al., A genome-wide screen to identify transcription factors expressed in pelvic ganglia of the lower urinary tract. Front Neurosci. 2012;6:130

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/23/2021
MGI 6.17
The Jackson Laboratory