About   Help   FAQ
NZF-2-pA, NZF-2-pB Primer Detail
Primers
  • Name
    NZF-2-pA, NZF-2-pB
  • Primer 1 Sequence
    ATACCTCTGTCCAGAAGGCG
  • Primer 2 Sequence
    TGTCATCATCAGAGCGAACC
  • ID
    MGI:2664949
  • Product Size
    102bp
  • Synonyms
    NZF-2com primers
Genes
Myt1 myelin transcription factor 1
Expression
  • Assay Results
    18
References
J:79522 Matsushita F, et al., NZF-2b is a novel predominant form of mouse NZF-2/MyT1, expressed in differentiated neurons especially at higher levels in newly generated ones. Mech Dev. 2002 Oct;118(1-2):209
J:207766 Matsushita F, et al., Spatiotemporal expression pattern of Myt/NZF family zinc finger transcription factors during mouse nervous system development. Dev Dyn. 2014 Apr;243(4):588-600

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
09/15/2020
MGI 6.15
The Jackson Laboratory