About   Help   FAQ
nS1, nSas1 Primer Detail
Primers
  • Name
    nS1, nSas1
  • Primer 1 Sequence
    GACCAAGCCAAGGTGCCTGTCCAG
  • Primer 2 Sequence
    CAGACAGTATTTTACCGATGAGTC
  • ID
    MGI:1351930
  • Product Size
    1.037kb
  • Synonyms
    Magel2-pF, Magel2-pR
Genes
Magel2 MAGE family member L2
Expression
  • Assay Results
    17
Polymorphisms
J:58785 Boccaccio I, et al., Hum Mol Genet. 1999 Dec;8(13):2497-505
Endonuclease Gene Allele Fragments Strains
MboII Magel2 b 0.344, 0.253, 0.452kb C57BL/6J
s 0.344, 0.705kb M. spretus
References
J:58785 Boccaccio I, et al., The human MAGEL2 gene and its mouse homologue are paternally expressed and mapped to the Prader-Willi region. Hum Mol Genet. 1999 Dec;8(13):2497-505
J:143569 Miller NL, et al., Necdin, a Prader-Willi syndrome candidate gene, regulates gonadotropin-releasing hormone neurons during development. Hum Mol Genet. 2009 Jan 15;18(2):248-60

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
08/09/2022
MGI 6.21
The Jackson Laboratory