Summary | Mutation origin | Mutation description | Expression | Phenotypes | Find Mice (IMSR) | References

Symbol:	Pole3em4Tbo
Name:	polymerase (DNA directed), epsilon 3 (p17 subunit); endonuclease-mediated mutation 4, Thomas Boehm
MGI ID:	MGI:6490636
Synonyms:	Pole3m4
Gene:	Pole3  Location: Chr4:62440889-62443305 bp, - strand  Genetic Position: Chr4, 33.17 cM, cytoband C1
Alliance:	Pole3em4Tbo page

Strain of Origin:

FVB

Allele Type:    Endonuclease-mediated (Not Applicable) Mutation:    Insertion   Mutation details: A 2 bp insertion (GC or CG) in the 3' end of the coding region was created using sgRNAs (targeting CGGGAGCAGAAAGGCAAG) and an ssODN template (CGGTTTGTCTAATTAAACCATAATATCCTGCTTCCTTACAGCGTACAGGCAGGAACAGAAGGGCAAGAAGGAGGCTTCGGAGCAAAAGAAGAAGGACAAAGACAAAAAGGA) with CRISPR/Cas9 technology. The resulting frameshift creates a large net positive charge on the normally negatively charged tail of the encoded peptide. (J:298827)

View phenotypes and curated references for all genotypes (concatenated display).

In Structures Affected by this Mutation:

2 anatomical structure(s)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Pole3 Mutation:	14 strains or lines available

Original:	J:298827 Siamishi I, et al., Lymphocyte-Specific Function of the DNA Polymerase Epsilon Subunit Pole3 Revealed by Neomorphic Alleles. Cell Rep. 2020 Jun 16;31(11):107756
All:	1 reference(s)