Summary | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Irf8em3Kmm
Name:	interferon regulatory factor 8; endonuclease-mediated mutation 3, Kenneth Murphy
MGI ID:	MGI:6368524
Synonyms:	Irf8 -50-, Rr174em3Kmm
Gene:	Irf8  Location: Chr8:121463097-121483433 bp, + strand  Genetic Position: Chr8, 70.05 cM
Alliance:	Irf8em3Kmm page

Strain of Origin:

C57BL/6J

Allele Type:    Endonuclease-mediated (Modified regulatory region) Mutation:    Intragenic deletion   Mutation details: Plasmids encoding sgRNA (ggtgacatctgtctacggag, and atgcacccaaggcctggctc) are designed to delete one of the enhancers located in the super-enhancer region of the gene -50 kb upstream from the transcriptional start site. The region contains two PU.1 (Spi1)-binding sites. (J:279982)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Irf8 Mutation:	32 strains or lines available

Original:	J:279982 Durai V, et al., Cryptic activation of an Irf8 enhancer governs cDC1 fate specification. Nat Immunol. 2019 Sep;20(9):1161-1173
All:	1 reference(s)