Summary | Mutation origin | Mutation description | Phenotypes | Find Mice (IMSR) | References

Symbol:	Polr2lem1(IMPC)J
Name:	polymerase (RNA) II (DNA directed) polypeptide L; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:6258608
Gene:	Polr2l  Location: Chr7:141051773-141055045 bp, - strand  Genetic Position: Chr7, 86.83 cM
Alliance:	Polr2lem1(IMPC)J page
IMPC:	Polr2l gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAGTCTGTAGGCCTTGCTA and CTATCCACACGAATACCCAG, which resulted in a 1828 bp deletion beginning at Chromosome 7 position 141,471,653 bp and ending after 141,473,480 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000668186 (exon 2) and 283 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 32 and immediate truncation probably due to run on into the intron. (J:188991) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Polr2l Mutation:	12 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	2 reference(s)