Summary | Mutation origin | Mutation description | Expression | Phenotypes | Find Mice (IMSR) | References

Symbol:	Smg9em1(IMPC)J
Name:	SMG9 nonsense mediated mRNA decay factor; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:5616624
Synonyms:	Smg9em1J
Gene:	Smg9  Location: Chr7:24099106-24122197 bp, + strand  Genetic Position: Chr7, 10.54 cM
Alliance:	Smg9em1(IMPC)J page
IMPC:	Smg9 gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Hypomorph) Mutations:    Insertion, Intragenic deletion   Mutation details: This allele from project Smg9-6001-MP6R was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence TCTACGGGATAGAGCGGCGG, which resulted in a 2 bp deletion GG and a 10 bp insertion CTGGGTTCTA in exon 2 beginning at Chromosome 7 positive strand approximate position 24,403,446 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 15 and early truncation 88 amino acids later. QRT-PCR confirmed a severe reduction in transcript expression. (J:188991, J:231968) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

In Structures Affected by this Mutation:

7 anatomical structure(s)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Smg9 Mutation:	40 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	3 reference(s)