Rbbp8^em1Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rbbp8^em1Tcp
• Name: retinoblastoma binding protein 8, endonuclease; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:8293390
• Gene: Rbbp8 Location: Chr18:11766333-11876264 bp, + strand Genetic Position: Chr18, 5.85 cM
• Alliance: Rbbp8^em1Tcp page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Translocation
• Mutation details:

  This allele was generated at The Centre for Phenogenomics by injecting Cas9 endonuclease and a guide RNA with the spacer sequence TTTGGCAGATAGCTTCTCCC and a single-strand oligonucleotide encoding the changes c.2227C>T, p.Q743X and c.2230_2333GTAC>ATAT to inactivate the PAM sequence and introduce an EcoRV site downstream of the introduced stop codon in ENSMUST00000047322 (NM_001081223). The coding change is the same as the ENU-derived allele Rbbp8^Sum6-Jus. (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rbbp8 Mutation: 51 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)