Birc6^em2Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Birc6^em2Tcp
• Name: baculoviral IAP repeat-containing 6; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:8293357
• Gene: Birc6 Location: Chr17:74835290-75010351 bp, + strand Genetic Position: Chr17, 45.64 cM, cytoband E3
• Alliance: Birc6^em2Tcp page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details:

  This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with a guide RNA with the spacer sequence GAACGAGCTCTTCGATGGGG and a single-strand oligonucleotide repair template. The resultant allele did not incorporate the repair template instead it was repaired by non-homologous end joining resulting in a 1-bp deletion of the C at Chr17:74643355 (GRCm39) predicted to result in a frameshift and early stop codon (c.9606delC) (p.H3203I*fs32). (J:322048)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Birc6 Mutation: 242 strains or lines available

References

• Original: J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022
• All: 1 reference(s)