Mmp28^{em1(IMPC)Hmgu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mmp28^{em1(IMPC)Hmgu}
• Name: matrix metallopeptidase 28 (epilysin); endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
• MGI ID: MGI:8220267
• Gene: Mmp28 Location: Chr11:83331594-83353890 bp, - strand Genetic Position: Chr11, 50.39 cM
• Alliance: Mmp28^{em1(IMPC)Hmgu} page
• IMPC: Mmp28 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Helmholtz-Zentrum Muenchen using Cas9 and guides with spacer sequences AACAATGCCGGATTATACGA and ATGAGGAGCTAACTGCTAAT that targeted exon(s) ENSMUSE00000107903.2 ENSMUSE00001284831.2 ENSMUSE00002019173.1. This resulted in deletion(s) of 1138 bp (location: Chr11:83341651-83342788; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mmp28 Mutation: 31 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)