Nvl^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nvl^em1(IMPC)Tcp
• Name: nuclear VCP-like; endonuclease-mediated mutation 1, Toronto Centre for Phenogenomics
• MGI ID: MGI:8203403
• Gene: Nvl Location: Chr1:180914703-180971769 bp, - strand Genetic Position: Chr1, 84.53 cM, cytoband H4
• Alliance: Nvl^em1(IMPC)Tcp page
• IMPC: Nvl gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences AAGAACAGTCAGCCGGTCAC and CAAGCCAATTCAATTAAGGG that targeted exon(s) ENSMUSE00000160122.4 ENSMUSE00000160130.4 ENSMUSE00000160137.2 ENSMUSE00000160138.2 ENSMUSE00000160141.2. This resulted in deletion(s) of 8468 bp (location: Chr1:180951176-180959643; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Nvl Mutation: 58 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)