Atp6ap1l^{em1(IMPC)Hmgu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Atp6ap1l^{em1(IMPC)Hmgu}
• Name: ATPase, H+ transporting, lysosomal accessory protein 1-like; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
• MGI ID: MGI:7863669
• Gene: Atp6ap1l Location: Chr13:91031558-91053478 bp, - strand Genetic Position: Chr13, 46.45 cM
• Alliance: Atp6ap1l^{em1(IMPC)Hmgu} page
• IMPC: Atp6ap1l gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Helmholtz-Zentrum Muenchen using Cas9 and guides with spacer sequences AAGGCTGGAGTAGTTATTCC, CAGTTTTCTAGTTTTCCCGC, GTTGGTTAGGTAGGTGCATG, and TGGATTACGCAGAGCCTCTA that targeted exon(s) ENSMUSE00001272790.2. This resulted in deletion(s) of 585 bp (location: Chr13:91046549-91047133; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Atp6ap1l Mutation: 20 strains or lines available

References

• Original: J:82809 European Mouse Mutant Archive, Information obtained from the European Mouse Mutant Archive (EMMA). Unpublished. 2003-2013
• All: 2 reference(s)