Rr594em1Mrub
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rr594em1Mrub |
| Name: |
regulatory region 594; endonuclease-mediated mutation 1, Marcelo Rubinstein |
| MGI ID: |
MGI:7852714 |
| Synonyms: |
PomcdeltanPE3 |
| Gene: |
Rr594 Location: unknown Genetic Position: Chr12, Syntenic
|
| Alliance: |
Rr594em1Mrub page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Intergenic deletion
|
| |
|
Mutation details: Hypothalamic neuron-specific Pomc enhancer nPE3, located upstream, was targeted using sgRNAs (equivalent to CCTGTGTGGACGCCCGCCTGAGG and TCCTTCAGCTGGTTCCAAGGAGG) with CRISPR/Cas9 technology, resulting in its deletion. This allele was created in zygotes heterozygous for the Rr596tm1.1Low allele (where enhancers Rr279 (nPE1) and Rr280 (nPE2) are deleted). Eight founder mice were created, with four different deletions and one deletion-insertion amongst them. A founder strain carrying only a 629 bp deletion (GRCm39:chr12:3986460-3987088) of nPE3 (Rr594) was selected.
(J:357475)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rr594 Mutation: |
0 strains or lines available
|
|
| Original: |
J:357475 Rojo D, et al., A mammalian tripartite enhancer cluster controls hypothalamic Pomc expression, food intake, and body weight. Proc Natl Acad Sci U S A. 2024 Apr 30;121(18):e2322692121 |
| All: |
1 reference(s) |
|