Rr594^em1Mrub
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr594^em1Mrub
• Name: regulatory region 594; endonuclease-mediated mutation 1, Marcelo Rubinstein
• MGI ID: MGI:7852714
• Synonyms: Pomc^deltanPE3
• Gene: Rr594 Location: unknown Genetic Position: Chr12, Syntenic
• Alliance: Rr594^em1Mrub page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: Hypothalamic neuron-specific Pomc enhancer nPE3, located upstream, was targeted using sgRNAs (equivalent to CCTGTGTGGACGCCCGCCTGAGG and TCCTTCAGCTGGTTCCAAGGAGG) with CRISPR/Cas9 technology, resulting in its deletion. This allele was created in zygotes heterozygous for the Rr596^tm1.1Low allele (where enhancers Rr279 (nPE1) and Rr280 (nPE2) are deleted). Eight founder mice were created, with four different deletions and one deletion-insertion amongst them. A founder strain carrying only a 629 bp deletion (GRCm39:chr12:3986460-3987088) of nPE3 (Rr594) was selected. (J:357475)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr594 Mutation: 0 strains or lines available

References

• Original: J:357475 Rojo D, et al., A mammalian tripartite enhancer cluster controls hypothalamic Pomc expression, food intake, and body weight. Proc Natl Acad Sci U S A. 2024 Apr 30;121(18):e2322692121
• All: 1 reference(s)