Del(5Rr112505-Rr112506)6Andg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(5Rr112505-Rr112506)6Andg
• Name: deletion, Chr 5, Guillaume Andrey 6
• MGI ID: MGI:7788892
• Synonyms: CTCF^i4:i5:zrs:i9
• Gene: Del(5Rr112505-Rr112506)6Andg Location: unknown Genetic Position: Chr5, Syntenic

Mutation origin

• Strain of Origin: (129S6/SvEvTac x C57BL/6NCrl)F1

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: Three Shh-enhancer-related CTCF-binding sites, located in a Lmbr1 intron, were targeted using sgRNAs (equivalent to AGGGCGTCAGGAAATTCCAC and TGAACTGCCAATCACCTGGG) with CRISPR/Cas9 technology, resulting in their deletion. This allele was created in ES cells carrying the Rr112510^em2Andg, Rr112507^em1Andg and Rr29^em2Andg CTCF-bs deletion alleles and represents two possible deletions (GRCm39:chr5:29475428-29481255 and chr5:29475816-29481294). (J:359453)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Del(5Rr112505-Rr112506)6Andg Mutation: 0 strains or lines available

References

• Original: J:359453 Harke J, et al., Multiple allelic configurations govern long-range Shh enhancer-promoter communication in the embryonic forebrain. Mol Cell. 2024 Nov 14
• All: 1 reference(s)