About   Help   FAQ
Del(5Rr695604-Rr608832)6Andg
Endonuclease-mediated Allele Detail
Summary
Symbol: Del(5Rr695604-Rr608832)6Andg
Name: deletion, Chr 5, Guillaume Andrey 6
MGI ID: MGI:7788892
Synonyms: CTCFi4:i5:zrs:i9, Del(5Rr112505-Rr112506)6Andg
Gene: Del(5Rr695604-Rr608832)6Andg  Location: unknown  Genetic Position: Chr5, Syntenic
Mutation
origin
Strain of Origin:  (129S6/SvEvTac x C57BL/6NCrl)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
  Del(5Rr695604-Rr608832)6Andg involves 3 genes/genome features (Rr695604, Rr608831, Rr608832) View all
 
Mutation detailsThree Shh-enhancer-related CTCF-binding sites, located in a Lmbr1 intron, were targeted using sgRNAs (equivalent to AGGGCGTCAGGAAATTCCAC and TGAACTGCCAATCACCTGGG) with CRISPR/Cas9 technology, resulting in their deletion. This allele was created in ES cells carrying the Rr112510em2Andg, Rr112507em1Andg and Rr29em2Andg CTCF-bs deletion alleles and represents two possible deletions (GRCm39:chr5:29475428-29481255 and chr5:29475816-29481294). (J:359453)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Del(5Rr695604-Rr608832)6Andg Mutation:  0 strains or lines available
References
Original:  J:359453 Harke J, et al., Multiple allelic configurations govern long-range Shh enhancer-promoter communication in the embryonic forebrain. Mol Cell. 2024 Nov 14;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory