Rr112507^em1Andg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr112507^em1Andg
• Name: regulatory region 112507; endonuclease-mediated mutation 1, Guillaume Andrey
• MGI ID: MGI:7703762
• Synonyms: deltaCTCF i5
• Gene: Rr112507 Location: Chr5:29498201-29498800 bp Genetic Position: Chr5, Syntenic
• Alliance: Rr112507^em1Andg page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:276559
• Parent Cell Line: G4 (ES Cell)
• Strain of Origin: (129S6/SvEvTac x C57BL/6NCrl)F1

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: The CTCF-binding site, located in Lmbr1 intron 5, was deleted using an sgRNA with CRISPR/Cas9 technology. This allele represents two different deletions (CTAGTGGCCAA on one copy of chromosome 5 and CTGGAGTCCTCTAGTGGCCAACTGGAGAA on the other) that overlap/contain the binding site AGTCCTCTAGTGGCCAACT. (J:276559)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr112507 Mutation: 0 strains or lines available

References

• Original: J:276559 Paliou C, et al., Preformed chromatin topology assists transcriptional robustness of Shh during limb development. Proc Natl Acad Sci U S A. 2019 Jun 18;116(25):12390-12399
• All: 2 reference(s)