About   Help   FAQ
Ifngr2em1(IMPC)Ics
Endonuclease-mediated Allele Detail
Summary
Symbol: Ifngr2em1(IMPC)Ics
Name: interferon gamma receptor 2; endonuclease-mediated mutation 1, Mouse Clinical Institute
MGI ID: MGI:7781816
Gene: Ifngr2  Location: Chr16:91343947-91360895 bp, + strand  Genetic Position: Chr16, 53.07 cM
Alliance: Ifngr2em1(IMPC)Ics page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at the Institut Clinique de la Souris by electroporating Cas9 protein and 4 sgRNAs (equivalent to CTGTGGTCCCCACGACCTAG, CTCTAGGTCGTGGGGACCAC,CCGGGCTTTCAGCATGACTA and ATAGTCATGCTGAAAGCCCG), resulting in a 521 bp deletion that includes exon 2 (ENSMUSE00000132198; GRCm39), leading to a frameshift and premature stop codon. (J:358405)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ifngr2 Mutation:  24 strains or lines available
References
Original:  J:358405 MGI and ICS/MCI, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC) Generated by ICS/MCI. Database Release. 2024;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory