About   Help   FAQ
Rr427em3Rdw
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr427em3Rdw
Name: regulatory region 427; endonuclease-mediated mutation 3, Ruud Delwel
MGI ID: MGI:7767994
Synonyms: +42Mkb-
Gene: Rr427  Location: unknown  Genetic Position: Chr7, Syntenic
Alliance: Rr427em3Rdw page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe Cebpa enhancer was targeted using sgRNAs (equivalent to TGAAGCCTACACTACTTTGT, AGAGGTAGGAACTCCATTCC, AGAGCCTCGCTCAAGCCCAT and TTGAGACATCTGGTAACCTT) with CRISPR/Cas9 technology, resulting in an ~0.65 kb deletion. (J:357893)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr427 Mutation:  0 strains or lines available
References
Original:  J:357893 Avellino R, et al., An autonomous CEBPA enhancer specific for myeloid-lineage priming and neutrophilic differentiation. Blood. 2016 Jun 16;127(24):2991-3003
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory