Rr427^em1Rdw
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr427^em1Rdw
• Name: regulatory region 427; endonuclease-mediated mutation 1, Ruud Delwel
• MGI ID: MGI:7767991
• Synonyms: +42^Mkb^-
• Gene: Rr427 Location: unknown Genetic Position: Chr7, Syntenic
• Alliance: Rr427^em1Rdw page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The Cebpa enhancer was targeted using sgRNAs (equivalent to TGAAGCCTACACTACTTTGT, AGAGGTAGGAACTCCATTCC, AGAGCCTCGCTCAAGCCCAT and TTGAGACATCTGGTAACCTT) with CRISPR/Cas9 technology, resulting in an ~1.1 kb deletion. (J:357893)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr427 Mutation: 0 strains or lines available

References

• Original: J:357893 Avellino R, et al., An autonomous CEBPA enhancer specific for myeloid-lineage priming and neutrophilic differentiation. Blood. 2016 Jun 16;127(24):2991-3003
• All: 1 reference(s)