About   Help   FAQ
Rr427em1Kmm
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr427em1Kmm
Name: regulatory region 427; endonuclease-mediated mutation 1, Kenneth M Murphy
MGI ID: MGI:7767906
Synonyms: Cebpa +37-
Gene: Rr427  Location: unknown  Genetic Position: Chr7, Syntenic
Alliance: Rr427em1Kmm page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe Cebpa enhancer was targeted using sgRNAs (equivalent to AGGGCAATTTCAGCCCCAAG and ACGTAGACCCTCTCCTGACA) with CRISPR/Cas9 technology, resulting in a 552 bp deletion (GRCm39:chr:34855789-34856340). (J:354615)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr427 Mutation:  0 strains or lines available
References
Original:  J:354615 Kim S, et al., Transcription factor C/EBPalpha is required for the development of Ly6C(hi) monocytes but not Ly6C(lo) monocytes. Proc Natl Acad Sci U S A. 2024 Apr 9;121(15):e2315659121
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory