Rr427^em1Kmm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr427^em1Kmm
• Name: regulatory region 427; endonuclease-mediated mutation 1, Kenneth M Murphy
• MGI ID: MGI:7767906
• Synonyms: Cebpa +37^-
• Gene: Rr427 Location: unknown Genetic Position: Chr7, Syntenic
• Alliance: Rr427^em1Kmm page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The Cebpa enhancer was targeted using sgRNAs (equivalent to AGGGCAATTTCAGCCCCAAG and ACGTAGACCCTCTCCTGACA) with CRISPR/Cas9 technology, resulting in a 552 bp deletion (GRCm39:chr:34855789-34856340). (J:354615)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr427 Mutation: 0 strains or lines available

References

• Original: J:354615 Kim S, et al., Transcription factor C/EBPalpha is required for the development of Ly6C(hi) monocytes but not Ly6C(lo) monocytes. Proc Natl Acad Sci U S A. 2024 Apr 9;121(15):e2315659121
• All: 1 reference(s)