About   Help   FAQ
Acrv1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Acrv1em1(IMPC)J
Name: acrosomal vesicle protein 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7763937
Gene: Acrv1  Location: Chr9:36604550-36610139 bp, + strand  Genetic Position: Chr9, 20.67 cM
Alliance: Acrv1em1(IMPC)J page
IMPC: Acrv1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: TAACTCCTTCATTTTGATTT and CTTCTTGCTCTGACTTAGGC. This resulted in a 5,361 bp deletion of Chr9:36,693,302-36,698,662 (GRCm38/mm10) that removes exon ENSMUSE00000216596 through ENSMUSE00000395690. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Acrv1 Mutation:  11 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory