Ccdc93^em1Sgan
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc93^em1Sgan
• Name: coiled-coil domain containing 93; endonuclease-mediated mutation 1, Santhi K Ganesh
• MGI ID: MGI:7751862
• Synonyms: Ccdc93^-
• Gene: Ccdc93 Location: Chr1:121358796-121434189 bp, + strand Genetic Position: Chr1, 52.97 cM, cytoband E2
• Alliance: Ccdc93^em1Sgan page

Mutation origin

• Strain of Origin: (C57BL/6 x SJL)F1

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Using CRISPR/Cas9 endonuclease-mediated genome editing, a single guide RNA (GGCGAAAGTACCGACGGCAG) was used to generate a 21-nucleotide deletion in a region spanning intron 6/exon 7 (2 nucleotides in intron 6 and 19 nucleotides in exon 7) of the coiled-coil domain containing 93 (Ccdc93) gene on chromosome 1. (J:354232)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ccdc93 Mutation: 54 strains or lines available

References

• Original: J:354232 Kumar N, et al., Genetic variation in CCDC93 is associated with elevated central systolic blood pressure, impaired arterial relaxation, and mitochondrial dysfunction. PLoS Genet. 2024 Sep;20(9):e1011151
• All: 1 reference(s)