About   Help   FAQ
Ccdc93em1Sgan
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccdc93em1Sgan
Name: coiled-coil domain containing 93; endonuclease-mediated mutation 1, Santhi K Ganesh
MGI ID: MGI:7751862
Synonyms: Ccdc93-
Gene: Ccdc93  Location: Chr1:121358796-121434189 bp, + strand  Genetic Position: Chr1, 52.97 cM, cytoband E2
Alliance: Ccdc93em1Sgan page
Mutation
origin
Strain of Origin:  (C57BL/6 x SJL)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsUsing CRISPR/Cas9 endonuclease-mediated genome editing, a single guide RNA (GGCGAAAGTACCGACGGCAG) was used to generate a 21-nucleotide deletion in a region spanning intron 6/exon 7 (2 nucleotides in intron 6 and 19 nucleotides in exon 7) of the coiled-coil domain containing 93 (Ccdc93) gene on chromosome 1. (J:354232)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ccdc93 Mutation:  54 strains or lines available
References
Original:  J:354232 Kumar N, et al., Genetic variation in CCDC93 is associated with elevated central systolic blood pressure, impaired arterial relaxation, and mitochondrial dysfunction. PLoS Genet. 2024 Sep;20(9):e1011151
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory