About   Help   FAQ
Rr343500em1Zkoz
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr343500em1Zkoz
Name: regulatory region 343500; endonuclease-mediated mutation 1, Zbynek Kozmik
MGI ID: MGI:7720870
Synonyms: TdeltaT3
Gene: Rr343500  Location: Chr17:8615002-8615800 bp  Genetic Position: Chr17, Syntenic
Alliance: Rr343500em1Zkoz page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
 
Mutation detailsBrachyury enhancer T3, overlapping a T2 gene exon and introns, was targeted using crRNAs/tracrRNAs (targeting TTAGCAGACTCACATTAGAG and CAAATGCAGACCGCCTCCTG) with CRISPR/Cas9 technology, resulting in a 1688 bp deletion (GRCm39:chr17:8614599-8616286). This allele was generated using zygotes containing the Rr343518em1Zkoz and Rr556em2Zkoz alleles (where the C and I enhancers are deleted). (J:341678)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr343500 Mutation:  0 strains or lines available
References
Original:  J:341678 Kemmler CL, et al., Conserved enhancers control notochord expression of vertebrate Brachyury. Nat Commun. 2023 Oct 18;14(1):6594
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory