Rr343518^em1Zkoz
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr343518^em1Zkoz
• Name: regulatory region 343518; endonuclease-mediated mutation 1, Zbynek Kozmik
• MGI ID: MGI:7720865
• Synonyms: T^deltaC
• Gene: Rr343518 Location: Chr17:8632401-8636599 bp Genetic Position: Chr17, Syntenic
• Alliance: Rr343518^em1Zkoz page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: Brachyury enhancer C, overlapping a T2 gene exon and introns, was targeted using crRNAs/tracrRNAs (targeting AATGCATTCGACCATCTCAG and ACTCAAATCAGGACCTTTTG) with CRISPR/Cas9 technology, resulting in a 567 bp deletion (GRCm39:chr17:8635673-8636239). (J:341678)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr343518 Mutation: 0 strains or lines available

References

• Original: J:341678 Kemmler CL, et al., Conserved enhancers control notochord expression of vertebrate Brachyury. Nat Commun. 2023 Oct 18;14(1):6594
• All: 1 reference(s)