Igs85^em2Pero
Endonuclease-mediated Allele Detail

Summary

• Symbol: Igs85^em2Pero
• Name: intergenic site 85; endonuclease-mediated mutation 2, Pedro P Rocha
• MGI ID: MGI:7718688
• Synonyms: CTCFi3x⁺
• Gene: Igs85 Location: Chr3:34778989-34778990 bp Genetic Position: Chr3, Syntenic
• Alliance: Igs85^em2Pero page

Mutation origin

• Strain of Origin: C57BL/6NCr

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Insertion
• Mutation details: The following 321 bp concatenation of three CTCF-binding-motif-containing sequences (in this order) was inserted between GRCm39:chr3:34778989 and 34778990 using an sgRNA (equivalent to CCTGTGCTGTACCTAATAGTAGC) and an ssODN template using CRISPR/Cas9 technology: reverse complement of GRCm39:chr8:13511990-13512089, chr1:34257543-34257652 and reverse complement of chr4:132978080-132978190. This allele was created using zygotes that contain the Igs84^em1Pero allele, where the same sequence was inserted in the opposite orientation upstream of this allele. (J:342647)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Igs85 Mutation: 0 strains or lines available

References

• Original: J:342647 Chakraborty S, et al., Enhancer-promoter interactions can bypass CTCF-mediated boundaries and contribute to phenotypic robustness. Nat Genet. 2023 Feb;55(2):280-290
• All: 1 reference(s)