About   Help   FAQ
Rr131em1Yqf
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr131em1Yqf
Name: regulatory region 131; endonuclease-mediated mutation 1, Yongqiang Feng
MGI ID: MGI:7718425
Synonyms: deltaCNS0,3
Gene: Rr131  Location: ChrX:7452855-7453034 bp  Genetic Position: ChrX, Syntenic
Alliance: Rr131em1Yqf page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
 
Mutation detailsFoxp3 enhancer CNS3 was targeted using sgRNAs (CAGUAAAGGUCGACACCUAU and CUCCCAAUCCUCAUCCCGAU) with CRISPR/Cas9 technology, resulting in a 180 bp deletion (GRCm39:chrX:7452855-7453034). This allele was created in zygotes that contain the Foxp3tm11.2Ayr allele, where enhancer CNS0 has been deleted and a GFP reporter gene fused inline to the 5' end of the Foxp3 CDS. (J:342283)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr131 Mutation:  0 strains or lines available
References
Original:  J:342283 Zong X, et al., Foxp3 enhancers synergize to maximize regulatory T cell suppressive capacity. J Exp Med. 2021 Aug 2;218(8)
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory