Rr124^em1Yqf
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr124^em1Yqf
• Name: regulatory region 124; endonuclease-mediated mutation 1, Yongqiang Feng
• MGI ID: MGI:7718424
• Synonyms: deltaCNS0,2
• Gene: Rr124 Location: ChrX:7450192-7450739 bp Genetic Position: ChrX, Syntenic
• Alliance: Rr124^em1Yqf page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: Foxp3 enhancer CNS2 was targeted using sgRNAs (AGACAGAAUCGAUAGAACUU and GAGCACUUCAAAAGUGACCA) with CRISPR/Cas9 technology, resulting in a 548 bp deletion (GRCm39:chrX:7450192-7450739). This allele was created in zygotes that contain the Foxp3^tm11.2Ayr allele, where enhancer CNS0 has been deleted and a GFP reporter gene fused inline to the 5' end of the Foxp3 CDS. (J:342283)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr124 Mutation: 0 strains or lines available

References

• Original: J:342283 Zong X, et al., Foxp3 enhancers synergize to maximize regulatory T cell suppressive capacity. J Exp Med. 2021 Aug 2;218(8)
• All: 1 reference(s)