Rr29^em7Axvi
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr29^em7Axvi
• Name: regulatory region 29; endonuclease-mediated mutation 7, Axel Visel
• MGI ID: MGI:7715223
• Synonyms: Shh-ZRS^em7Axvi
• Gene: Rr29 Location: Chr5:29519495-29520860 bp, + strand
• Alliance: Rr29^em7Axvi page

Mutation origin

• Strain of Origin: FVB

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence, Modified regulatory region)
• Mutation: Single point mutation
• Mutation details: A G>A mutation (GRCm39:chr5:29,520,267) was created in Shh enhancer ZRS or MFCS1 (mammals-fish conserved sequence 1), located in intron 5 of Lmbr1, using an sgRNA (targeting GAATGCATGCAGGAACTCAGGGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the 396C>T mutation in the human ZRS enhancer associated with polydactyly (coordinate in reference to 789 bp enhancer chr7:156,791,087156,791,875; hg38). (J:352731)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr29 Mutation: 2 strains or lines available

References

• Original: J:352731 Kvon EZ, et al., Comprehensive In Vivo Interrogation Reveals Phenotypic Impact of Human Enhancer Variants. Cell. 2020 Mar 19;180(6):1262-1271.e15
• All: 1 reference(s)