Rr504^em2Rlb
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr504^em2Rlb
• Name: regulatory region 504; endonuclease-mediated mutation 2, Robin Lovell-Badge
• MGI ID: MGI:7708021
• Synonyms: Enh13^-
• Gene: Rr504 Location: Chr11:112108104-112108661 bp Genetic Position: Chr11, Syntenic
• Alliance: Rr504^em2Rlb page

Mutation origin

• Strain of Origin: (C57BL/6 x CBA)F1

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: Embryonic testis-specific Sox9 enhancer Enh13 was deleted by targeting with four sgRNAs (equivalent to AGGGCTGCTCACAAGAAAAT, TTTACAAAATTGAATGTCTC, GCTGAGTGATATGTTTCTCA and AATAACAAACATTTACTGAT) using CRISPR/Cas9 technology in zygotes that carry the Rr505^em3Rlb allele. (J:263354)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr504 Mutation: 0 strains or lines available

References

• Original: J:263354 Gonen N, et al., Sex reversal following deletion of a single distal enhancer of Sox9. Science. 2018 Jun 29;360(6396):1469-1473
• All: 1 reference(s)