About   Help   FAQ
Rr505em3Rlb
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr505em3Rlb
Name: regulatory region 505; endonuclease-mediated mutation 3, Robin Lovell-Badge
MGI ID: MGI:5824335
Synonyms: Sox9em3Rlb, TES-
Gene: Rr505  Location: Chr11:112660478-112661770 bp  Genetic Position: Chr11, Syntenic
Alliance: Rr505em3Rlb page
Mutation
origin
Strain of Origin:  (C57BL/6 x CBA)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe TES (testis specific enhancer of Sox9) regulatory region 10-13 kb upstream of the gene was targeted with a pair of single guide RNAs (sgRNAs) using the CRISPR/Cas9 system. The proximal sgRNA (equivalent to GGGAACATTGGCAGGGCCCT) was targeted to sequence 20 bp downstream of the 3' end of the region. The distal sgRNA (equivalent to GAGGTGTGTGGAAGCGGGC) was targeted to sequence 25 bp upstream of the 5' end of the region. Two stable lines were established that carried the 3194 bp deletion between the Cas9 cleavage sites. This 3194 bp deletion deletes the entire 3161 bp TES sequence. (J:238708)
Expression
In Mice Carrying this Mutation: 42 assay results
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr505 Mutation:  0 strains or lines available
References
Original:  J:238708 Gonen N, et al., Normal Levels of Sox9 Expression in the Developing Mouse Testis Depend on the TES/TESCO Enhancer, but This Does Not Act Alone. PLoS Genet. 2017 Jan;13(1):e1006520
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory