Rr505em3Rlb
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rr505em3Rlb |
| Name: |
regulatory region 505; endonuclease-mediated mutation 3, Robin Lovell-Badge |
| MGI ID: |
MGI:5824335 |
| Synonyms: |
Sox9em3Rlb, TES- |
| Gene: |
Rr505 Location: Chr11:112660478-112661770 bp Genetic Position: Chr11, Syntenic
|
| Alliance: |
Rr505em3Rlb page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Intergenic deletion
|
| |
|
Mutation details: The TES (testis specific enhancer of Sox9) regulatory region 10-13 kb upstream of the gene was targeted with a pair of single guide RNAs (sgRNAs) using the CRISPR/Cas9 system. The proximal sgRNA (equivalent to GGGAACATTGGCAGGGCCCT) was targeted to sequence 20 bp downstream of the 3' end of the region. The distal sgRNA (equivalent to GAGGTGTGTGGAAGCGGGC) was targeted to sequence 25 bp upstream of the 5' end of the region. Two stable lines were established that carried the 3194 bp deletion between the Cas9 cleavage sites. This 3194 bp deletion deletes the entire 3161 bp TES sequence.
(J:238708)
|
|
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rr505 Mutation: |
0 strains or lines available
|
|
| Original: |
J:238708 Gonen N, et al., Normal Levels of Sox9 Expression in the Developing Mouse Testis Depend on the TES/TESCO Enhancer, but This Does Not Act Alone. PLoS Genet. 2017 Jan;13(1):e1006520 |
| All: |
2 reference(s) |
|