Rr501^em1Andir
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr501^em1Andir
• Name: regulatory region 501; endonuclease-mediated mutation 1, Anna di Rienzo
• MGI ID: MGI:7705937
• Synonyms: Epas1 mENH5 KO
• Gene: Rr501 Location: Chr17:87109165-87110166 bp Genetic Position: Chr17, Syntenic
• Alliance: Rr501^em1Andir page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: The Epas1 enhancer in intron 2 of the gene was deleted by targeting the sequence using sgRNAs (equivalent to ACGGCAAACATAAAGAGTGT and GGAAGGGGCCACACCCAAGC) with CRISPR/Cas9 technology. (J:351049)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr501 Mutation: 0 strains or lines available

References

• Original: J:351049 Gray OA, et al., A pleiotropic hypoxia-sensitive EPAS1 enhancer is disrupted by adaptive alleles in Tibetans. Sci Adv. 2022 Nov 25;8(47):eade1942
• All: 1 reference(s)