About   Help   FAQ
Rr500em1Jejo
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr500em1Jejo
Name: regulatory region 500; endonuclease-mediated mutation 1, Jane E Johnson
MGI ID: MGI:7705093
Synonyms: Ptf1aAR-DNT1
Gene: Rr500  Location: Chr2:19452843-19465279 bp  Genetic Position: Chr2, Syntenic
Alliance: Rr500em1Jejo page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsThe Ptf1a 3' dorsal neural tube enhancer was targeted by an sgRNA (equivalent to GGGTAACCATTGGTTTGATT) using CRISPR/Cas9 technology, resulting in a 32 bp deletion (GRCm39:chr2:19463819-19463850) overlapping the paired homeodomain (Pd-HD)-binding motif. This allele was created in conjunction with the Rr499em1Jejo allele. (J:297165)
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr500 Mutation:  0 strains or lines available
References
Original:  J:297165 Mona B, et al., Positive autofeedback regulation of Ptf1a transcription generates the levels of PTF1A required to generate itch circuit neurons. Genes Dev. 2020 May 1;34(9-10):621-636
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory