Rr500em1Jejo
Endonuclease-mediated Allele Detail
|
Symbol: |
Rr500em1Jejo |
Name: |
regulatory region 500; endonuclease-mediated mutation 1, Jane E Johnson |
MGI ID: |
MGI:7705093 |
Synonyms: |
Ptf1aAR-DNT1 |
Gene: |
Rr500 Location: Chr2:19452843-19465279 bp Genetic Position: Chr2, Syntenic
|
Alliance: |
Rr500em1Jejo page
|
|
Strain of Origin: |
Not Applicable
|
|
Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
Mutation: |
|
Intergenic deletion
|
|
|
Mutation details: The Ptf1a 3' dorsal neural tube enhancer was targeted by an sgRNA (equivalent to GGGTAACCATTGGTTTGATT) using CRISPR/Cas9 technology, resulting in a 32 bp deletion (GRCm39:chr2:19463819-19463850) overlapping the paired homeodomain (Pd-HD)-binding motif. This allele was created in conjunction with the Rr499em1Jejo allele.
(J:297165)
|
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Rr500 Mutation: |
0 strains or lines available
|
|
Original: |
J:297165 Mona B, et al., Positive autofeedback regulation of Ptf1a transcription generates the levels of PTF1A required to generate itch circuit neurons. Genes Dev. 2020 May 1;34(9-10):621-636 |
All: |
1 reference(s) |
|