Rr499em1Jejo
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rr499em1Jejo |
| Name: |
regulatory region 499; endonuclease-mediated mutation 1, Jane E Johnson |
| MGI ID: |
MGI:7705091 |
| Synonyms: |
Ptf1aAR-DNT1 |
| Gene: |
Rr499 Location: Chr2:19434901-19437198 bp Genetic Position: Chr2, Syntenic
|
| Alliance: |
Rr499em1Jejo page
|
|
| Strain of Origin: |
Not Applicable
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Intergenic deletion
|
| |
|
Mutation details: The Ptf1a 5' enhancer was targeted by two sgRNAs (equivalent to CACAAGTGGCGACATTCCCA and CCGCAGAGCACGCCAGTCCG) using CRISPR/Cas9 technology, resulting in an ~2.4 kb deletion containing the near and far autoregulatory PTF1-binding motifs. This allele was created in conjunction with the Rr500em1Jejo allele.
(J:297165)
|
|
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rr499 Mutation: |
0 strains or lines available
|
|
| Original: |
J:297165 Mona B, et al., Positive autofeedback regulation of Ptf1a transcription generates the levels of PTF1A required to generate itch circuit neurons. Genes Dev. 2020 May 1;34(9-10):621-636 |
| All: |
1 reference(s) |
|