Rr499^em1Jejo
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr499^em1Jejo
• Name: regulatory region 499; endonuclease-mediated mutation 1, Jane E Johnson
• MGI ID: MGI:7705091
• Synonyms: Ptf1a^AR-DNT1
• Gene: Rr499 Location: Chr2:19434901-19437198 bp Genetic Position: Chr2, Syntenic
• Alliance: Rr499^em1Jejo page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The Ptf1a 5' enhancer was targeted by two sgRNAs (equivalent to CACAAGTGGCGACATTCCCA and CCGCAGAGCACGCCAGTCCG) using CRISPR/Cas9 technology, resulting in an ~2.4 kb deletion containing the near and far autoregulatory PTF1-binding motifs. This allele was created in conjunction with the Rr500^em1Jejo allele. (J:297165)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr499 Mutation: 0 strains or lines available

References

• Original: J:297165 Mona B, et al., Positive autofeedback regulation of Ptf1a transcription generates the levels of PTF1A required to generate itch circuit neurons. Genes Dev. 2020 May 1;34(9-10):621-636
• All: 1 reference(s)