About   Help   FAQ
Rr496em2Andg
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr496em2Andg
Name: regulatory region 496; endonuclease-mediated mutation 2, Guillaume Andrey
MGI ID: MGI:7703479
Synonyms: Pitx1GFP
Gene: Rr496  Location: unknown  Genetic Position: Chr13, Syntenic
Alliance: Rr496em2Andg page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:317420
Parent Cell Line:  G4 (ES Cell)
Strain of Origin:  (129S6/SvEvTac x C57BL/6NCrl)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Reporter)
Mutation:    Insertion
 
Mutation detailsA DNA construct containing 50-bp of the beta-globin gene promoter upstream of the EGFP green fluorescent reporter gene was inserted upstream of the Pitx1 promoter using an sgRNA (targeting GAAACCGGGAGACGGTGATC GRCm39:chr13:55981823-55981842) with CRISPR/Cas9 technology. The reporter recapitulates Pitx1 expression. (J:317420)
Expression
In Mice Carrying this Mutation: 2 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr496 Mutation:  0 strains or lines available
References
Original:  J:317420 Rouco R, et al., Cell-specific alterations in Pitx1 regulatory landscape activation caused by the loss of a single enhancer. Nat Commun. 2021 Dec 13;12(1):7235
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory