Rr496^em1Andg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr496^em1Andg
• Name: regulatory region 496; endonuclease-mediated mutation 1, Guillaume Andrey
• MGI ID: MGI:7666669
• Synonyms: Sensor 1
• Gene: Rr496 Location: unknown Genetic Position: Chr13, Syntenic
• Alliance: Rr496^em1Andg page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:268374
• Parent Cell Line: G4 (ES Cell)
• Strain of Origin: (129S6/SvEvTac x C57BL/6NCrl)F1

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region, Reporter)
• Mutation: Insertion
• Mutation details: A DNA construct containing 50-bp of the beta-globin gene promoter upstream of the beta-galactosidase gene lacZ was inserted at GRCm39:chr13:55981839 upstream of the Pitx1 promoter using an sgRNA (equivalent to GAAACCGGGAGACGGTGATC) with CRISPR/Cas9 technology. The reporter recapitulates Pitx1 expression. (J:268374)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr496 Mutation: 0 strains or lines available

References

• Original: J:268374 Kragesteen BK, et al., Dynamic 3D chromatin architecture contributes to enhancer specificity and limb morphogenesis. Nat Genet. 2018 Oct;50(10):1463-1473
• All: 1 reference(s)