About   Help   FAQ
Rr493em2Andg
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr493em2Andg
Name: regulatory region 493; endonuclease-mediated mutation 2, Guillaume Andrey
MGI ID: MGI:7666638
Synonyms: Sensor 2
Gene: Rr493  Location: Chr13:56306831-56309000 bp  Genetic Position: Chr13, Syntenic
Alliance: Rr493em2Andg page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:268374
Parent Cell Line:  G4 (ES Cell)
Strain of Origin:  (129S6/SvEvTac x C57BL/6NCrl)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region, Reporter)
Mutation:    Insertion
 
Mutation detailsA DNA construct containing 50-bp of the beta-globin gene promoter upstream of the beta-galactosidase gene lacZ was inserted at GRCm39:chr13:56303701 next to Pitx1 pan-limb enhancer Pen using an sgRNA (equivalent to GAGAACAATGAGCGCATTGC) with CRISPR/Cas9 technology. (J:268374)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr493 Mutation:  0 strains or lines available
References
Original:  J:268374 Kragesteen BK, et al., Dynamic 3D chromatin architecture contributes to enhancer specificity and limb morphogenesis. Nat Genet. 2018 Oct;50(10):1463-1473
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory