About   Help   FAQ
Rr492em1Andg
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr492em1Andg
Name: regulatory region 492; endonuclease-mediated mutation 1, Guillaume Andrey
MGI ID: MGI:7666513
Synonyms: Pitx1del2
Gene: Rr492  Location: Chr13:56108910-56111397 bp  Genetic Position: Chr13, Syntenic
Alliance: Rr492em1Andg page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:268374
Parent Cell Line:  G4 (ES Cell)
Strain of Origin:  (129S6/SvEvTac x C57BL/6NCrl)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsA section of genomic sequence, containing Pitx1 distal or pituitary gland enhancer PDE or Pit, was deleted using sgRNAs (equivalent to GAAACCGGGAGACGGTGATC and TTCACACCTGTACTCTAGTG) with CRISPR/Cas9 technology. (J:268374)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr492 Mutation:  0 strains or lines available
References
Original:  J:268374 Kragesteen BK, et al., Dynamic 3D chromatin architecture contributes to enhancer specificity and limb morphogenesis. Nat Genet. 2018 Oct;50(10):1463-1473
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory