About   Help   FAQ
Del(13Rr492-Rr493)1Andg
Endonuclease-mediated Allele Detail
Summary
Symbol: Del(13Rr492-Rr493)1Andg
Name: deletion, Chr 13, Guillaume Andrey 1
MGI ID: MGI:7666512
Synonyms: Pitx1del1
Gene: Del(13Rr492-Rr493)1Andg  Location: unknown  Genetic Position: Chr13, Syntenic
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:268374
Parent Cell Line:  G4 (ES Cell)
Strain of Origin:  (129S6/SvEvTac x C57BL/6NCrl)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region, Null/knockout)
Mutations:    Intergenic deletion, Intragenic deletion
  Del(13Rr492-Rr493)1Andg involves 4 genes/genome features (Rr492, Rr494, Macroh2a1 ...) View all
 
Mutation detailsA section of genomic sequence, containing Pitx1 distal or pituitary gland enhancer PDE or Pit, Pitx1 enhancer RA4, the Macroh2a1 gene and Pitx1 pan-limb enhancer Pen, was deleted using sgRNAs (equivalent to GAAACCGGGAGACGGTGATC and CGTGCTATCGAGGGACTAAT ) with CRISPR/Cas9 technology. (J:268374)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Del(13Rr492-Rr493)1Andg Mutation:  0 strains or lines available
References
Original:  J:268374 Kragesteen BK, et al., Dynamic 3D chromatin architecture contributes to enhancer specificity and limb morphogenesis. Nat Genet. 2018 Oct;50(10):1463-1473
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory