Del(13Rr492-Rr493)1Andg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(13Rr492-Rr493)1Andg
• Name: deletion, Chr 13, Guillaume Andrey 1
• MGI ID: MGI:7666512
• Synonyms: Pitx1^del1
• Gene: Del(13Rr492-Rr493)1Andg Location: unknown Genetic Position: Chr13, Syntenic

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:268374
• Parent Cell Line: G4 (ES Cell)
• Strain of Origin: (129S6/SvEvTac x C57BL/6NCrl)F1

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region, Null/knockout)
• Mutations: Intergenic deletion, Intragenic deletion
• Del(13Rr492-Rr493)1Andg involves 1 genes/genome features (Macroh2a1) View all
• Mutation details: A section of genomic sequence, containing Pitx1 distal or pituitary gland enhancer PDE or Pit, Pitx1 enhancer RA4, the Macroh2a1 gene and Pitx1 pan-limb enhancer Pen, was deleted using sgRNAs (equivalent to GAAACCGGGAGACGGTGATC and CGTGCTATCGAGGGACTAAT ) with CRISPR/Cas9 technology. (J:268374)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Del(13Rr492-Rr493)1Andg Mutation: 0 strains or lines available

References

• Original: J:268374 Kragesteen BK, et al., Dynamic 3D chromatin architecture contributes to enhancer specificity and limb morphogenesis. Nat Genet. 2018 Oct;50(10):1463-1473
• All: 1 reference(s)