Rr493^em1Andg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr493^em1Andg
• Name: regulatory region 493; endonuclease-mediated mutation 1, Guillaume Andrey
• MGI ID: MGI:7666389
• Synonyms: Pitx1^Pen-, Pitx1^Pen
• Gene: Rr493 Location: Chr13:56306831-56309000 bp Genetic Position: Chr13, Syntenic
• Alliance: Rr493^em1Andg page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:268374
• Parent Cell Line: G4 (ES Cell)
• Strain of Origin: (129S6/SvEvTac x C57BL/6NCrl)F1

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: A 1.2-kb region, containing Pitx1 pan-limb enhancer Pen, was deleted using sgRNAs (equivalent to TGTGCTATCTAGGGAAGAAT and CGTGCTATCGAGGGACTAAT) with CRISPR/Cas9 technology, leading to a 45% loss of Pitx1 mRNA expression. (J:268374)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr493 Mutation: 0 strains or lines available

References

• Original: J:268374 Kragesteen BK, et al., Dynamic 3D chromatin architecture contributes to enhancer specificity and limb morphogenesis. Nat Genet. 2018 Oct;50(10):1463-1473
• All: 2 reference(s)