About   Help   FAQ
Txnrd1em1Lgr
Endonuclease-mediated Allele Detail
Summary
Symbol: Txnrd1em1Lgr
Name: thioredoxin reductase 1; endonuclease-mediated mutation 1, Laura G Reinholdt
MGI ID: MGI:7666123
Gene: Txnrd1  Location: Chr10:82669785-82733546 bp, + strand  Genetic Position: Chr10, 40.66 cM
Alliance: Txnrd1em1Lgr page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsUsing CRISPR/Cas9 technology, two sets of guide RNAs (gRNAs) were used (gRNA up 1:GGAGGCTGCAGCATCGCACT, gRNA down 1: GGGTTAATGATACTAGAGAT, gRNA up 2: GAGGCTGCAGCATCGCACTG, gRNA down 2: GGTTAATGATACTAGAGATA) to delete a 200-bp region containing the 75-bp SECIS translational regulatory element, as well as the flanking 3' UTR, of the thioredoxin reductase 1 (Txnr1) gene on chromosome 10. (J:348031)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Txnrd1 Mutation:  49 strains or lines available
References
Original:  J:348031 O'Connor C, et al., Unraveling the genetics of arsenic toxicity with cellular morphology QTL. PLoS Genet. 2024 Apr;20(4):e1011248
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory