About   Help   FAQ
Del(5Rr491-Rr490)4Mam
Endonuclease-mediated Allele Detail
Summary
Symbol: Del(5Rr491-Rr490)4Mam
Name: deletion, chr 5, Lothar Hennighausen 4; deletion, Chr 5, Lothar Hennighausen 4
MGI ID: MGI:7665221
Synonyms: Csn2-deltaP-E1/E2/E3
Gene: Del(5Rr491-Rr490)4Mam  Location: unknown  Genetic Position: Chr5, Syntenic
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutations:    Intergenic deletion, Nucleotide substitutions
  Del(5Rr491-Rr490)4Mam involves 4 genes/genome features (Rr491, Rr481, Rr482 ...) View all
 
Mutation detailsThe three Csn2 enhancers Rr481, Rr482 and Rr490 were deleted, and promoter Rr491 was modified with GRCm39:g.chr5:8784737C>T and 87847422G>A nucleotide mutations in two GAS motifs by targeting the promoter in zygotes that carry the Del(5Rr481-Rr490)3Mam allele (containing the enhancer deletions) using sgRNAs (equivalent to TCAATTCCAAGAAGTCTACGTGA and TTCTTGGGAAAGACAATAGA) and an ssODN template with CRISPR/Cas9 technology. (J:341588)
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Del(5Rr491-Rr490)4Mam Mutation:  0 strains or lines available
References
Original:  J:341588 Lee HK, et al., Cell-specific and shared regulatory elements control a multigene locus active in mammary and salivary glands. Nat Commun. 2023 Aug 17;14(1):4992
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory