Ywhaq^{em1(Ywhaz)Lmit}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ywhaq^{em1(Ywhaz)Lmit}
• Name: tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta; endonuclease-mediated mutation 1, Lars M Ittner
• MGI ID: MGI:7645438
• Synonyms: 14-3-3theta^zetaFx
• Gene: Ywhaq Location: Chr12:21440330-21467437 bp, - strand Genetic Position: Chr12, 8.31 cM
• Alliance: Ywhaq^{em1(Ywhaz)Lmit} page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Inserted expressed sequence)
• Mutations: Insertion, Intragenic deletion
• Ywhaq^{em1(Ywhaz)Lmit} expresses 1 gene
  Knock-in expresses:
  

  Organism	Expressed Gene	Note
  mouse	Ywhaz (MGI:109484)

• Mutation details: The 3' end of exon 3, entire intron 3 and the 5' end of exon 4, where the exonic sequences code for 31 amino acids comprising alpha-helix 6, was replaced with exon sequence coding for the equivalent 31 amino acid sequence from the zeta gene (Ywhaz), using sgRNAs (equivalent to ACGTAAGTATATTTGACCCA and TTGTTTCTGTGAGTTGAAAA) and an ssODN template with CRISPR/Cas9 technology. (J:348663)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ywhaq Mutation: 33 strains or lines available

References

• Original: J:348663 Ke YD, et al., Targeting 14-3-3theta-mediated TDP-43 pathology in amyotrophic lateral sclerosis and frontotemporal dementia mice. Neuron. 2024 Apr 17;112(8):1249-1264.e8
• All: 1 reference(s)