Rcsd1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rcsd1^em1(IMPC)J
• Name: RCSD domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7624530
• Gene: Rcsd1 Location: Chr1:165476503-165537632 bp, - strand Genetic Position: Chr1, 72.99 cM
• Alliance: Rcsd1^em1(IMPC)J page
• IMPC: Rcsd1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: TGGTGATCTCTCCCGCAGCA and TTGAGCCTCTAGTCCGCACC. This resulted in a 687 bp. deletion of Chr1:165,655,350-165,656,036 (GRCm38/mm10) and removes exon ENSMUSE00000397738. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rcsd1 Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)