Matr3^em1Lmjn
Endonuclease-mediated Allele Detail

Summary

• Symbol: Matr3^em1Lmjn
• Name: matrin 3; endonuclease-mediated mutation 1, Lauryl Nutter
• MGI ID: MGI:7606214
• Gene: Matr3 Location: Chr18:35695191-35726888 bp, + strand Genetic Position: Chr18, 19.14 cM, cytoband C
• Alliance: Matr3^em1Lmjn page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, No functional change)
• Mutation: Insertion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with a guide RNAs with the spacer sequences TGCTCTGATATCTAATATTG and GAACCACGAGAGTTGGTCAT. A single repair template containing the loxP sites, intervening sequence and flanking homology arms was delivered by incubating embryos with recombinant AAV. This resulting allele has loxP sites flanking exons ENSMUSE00000337447, ENSMUSE00000360581, and ENSMUSE00000341974 (GRCm39). Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele. (J:344138)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Matr3 Mutation: 113 strains or lines available

References

• Original: J:344138 The Centre for Phenogenomics, Strains and alleles submitted by The Centre for Phenogenomics. MGI Direct Data Submission. 2024
• All: 1 reference(s)