About   Help   FAQ
Myh11em1Yaim
Endonuclease-mediated Allele Detail
Summary
Symbol: Myh11em1Yaim
Name: myosin, heavy polypeptide 11, smooth muscle; endonuclease-mediated mutation 1, Yasushi Imai
MGI ID: MGI:7574150
Synonyms: Myh11deltaK
Gene: Myh11  Location: Chr16:14012392-14109227 bp, - strand  Genetic Position: Chr16, 9.71 cM
Alliance: Myh11em1Yaim page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Intragenic deletion
 
Mutation detailsLysine codon 1256 (or 1257, 1258, 1259) (AAG) in exon 28 was deleted (p.K1256del) using gRNAs (targeting CCAGGCGAAGCAGGAGGTGGAAC and CCTGCAGCTGCACCTCCAGCTTC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with familial thoracic aortic aneurysms and dissections (FTAAD). (J:344092)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Myh11 Mutation:  96 strains or lines available
References
Original:  J:344092 Negishi K, et al., An Myh11 single lysine deletion causes aortic dissection by reducing aortic structural integrity and contractility. Sci Rep. 2022 May 25;12(1):8844
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory