Myh11^em1Yaim
Endonuclease-mediated Allele Detail

Summary

• Symbol: Myh11^em1Yaim
• Name: myosin, heavy polypeptide 11, smooth muscle; endonuclease-mediated mutation 1, Yasushi Imai
• MGI ID: MGI:7574150
• Synonyms: Myh11^deltaK
• Gene: Myh11 Location: Chr16:14012392-14109227 bp, - strand Genetic Position: Chr16, 9.71 cM
• Alliance: Myh11^em1Yaim page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Intragenic deletion
• Mutation details: Lysine codon 1256 (or 1257, 1258, 1259) (AAG) in exon 28 was deleted (p.K1256del) using gRNAs (targeting CCAGGCGAAGCAGGAGGTGGAAC and CCTGCAGCTGCACCTCCAGCTTC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with familial thoracic aortic aneurysms and dissections (FTAAD). (J:344092)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Myh11 Mutation: 96 strains or lines available

References

• Original: J:344092 Negishi K, et al., An Myh11 single lysine deletion causes aortic dissection by reducing aortic structural integrity and contractility. Sci Rep. 2022 May 25;12(1):8844
• All: 1 reference(s)