Sfxn2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sfxn2^em1(IMPC)J
• Name: sideroflexin 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7568767
• Gene: Sfxn2 Location: Chr19:46561798-46585340 bp, + strand Genetic Position: Chr19, 38.96 cM, cytoband D1
• Alliance: Sfxn2^em1(IMPC)J page
• IMPC: Sfxn2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTCGAGATGGATGAACACGT and CCTCAAATATCAGGGTGGGA, which resulted in a 2681 bp deletion beginning at Chromosome 19 position 46,587,902 bp and ending after 46,590,582 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000147421,ENSMUSE00000147411, ENSMUSE00000147418, and ENSMUSE00000147415 (exons 5-8) and 2391 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 143 and early stop 50 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Sfxn2 Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)