About   Help   FAQ
Prdm14em1Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Prdm14em1Tcp
Name: PR domain containing 14; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:7565731
Gene: Prdm14  Location: Chr1:13183681-13197387 bp, - strand  Genetic Position: Chr1, 4.1 cM
Alliance: Prdm14em1Tcp page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Epitope tag)
Mutation:    Insertion
 
Mutation detailsThis allele was generated at The Centre for Phenogenomics by injecting Cas9 protein and a synthetic crRNA with sequence CCGCAAAACUCAGCUUGCGA targeting the 5' side of exon ENSMUSE00000316434 and a single-strand oligonucleotide encoding a 3xHis tag. The 3xHis tag was inserted adjacent to the ATG codon of Prdm14 (c.3_4insCACCACCACCACCACCAC). (J:322048)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Prdm14 Mutation:  52 strains or lines available
References
Original:  J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory