Prdm14^em1Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prdm14^em1Tcp
• Name: PR domain containing 14; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7565731
• Gene: Prdm14 Location: Chr1:13183681-13197387 bp, - strand Genetic Position: Chr1, 4.1 cM
• Alliance: Prdm14^em1Tcp page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Epitope tag)
• Mutation: Insertion
• Mutation details: This allele was generated at The Centre for Phenogenomics by injecting Cas9 protein and a synthetic crRNA with sequence CCGCAAAACUCAGCUUGCGA targeting the 5' side of exon ENSMUSE00000316434 and a single-strand oligonucleotide encoding a 3xHis tag. The 3xHis tag was inserted adjacent to the ATG codon of Prdm14 (c.3_4insCACCACCACCACCACCAC). (J:322048)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Prdm14 Mutation: 51 strains or lines available

References

• Original: J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022
• All: 1 reference(s)