Igs2^em1Lmjn
Endonuclease-mediated Allele Detail

Summary

• Symbol: Igs2^em1Lmjn
• Name: intergenic site 2; endonuclease-mediated mutation 1, Lauryl Nutter
• MGI ID: MGI:7565730
• Synonyms: Igs2^em1Tcp
• Gene: Igs2 Location: Chr11:3195460-3195497 bp Genetic Position: Chr11, Syntenic
• Alliance: Igs2^em1Lmjn page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Insertion
• Mutation details: This allele was generated at The Centre for Phenogenomics by injecting / electroporating Cas9 ribonucleoprotein complexes with a guide RNA with the spacer sequence GCTGATGGAACAGGTAACAA and an AAV repair template to insert a Bxb1 IMCE cassette comprised of a Bxb1 attP-GT site, a spacer sequence, and a Bxb1 attP-GA stie. This resulted in insertion of the Bxb1 IMCE cassette after Chr11:3195464 (GRCm39). This insertion should enable Bxb1 integrase-mediated cassette exchange with an appropriate vector and Bxb1 mRNA. (J:322048)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Igs2 Mutation: 72 strains or lines available

References

• Original: J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022
• All: 1 reference(s)