Lck^em1Ewyh
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lck^em1Ewyh
• Name: lymphocyte protein tyrosine kinase; endonuclease-mediated mutation 1, Elena W Y Hsieh
• MGI ID: MGI:7565561
• Synonyms: Lck^P440S
• Gene: Lck Location: Chr4:129442142-129467415 bp, - strand Genetic Position: Chr4, 63.26 cM, cytoband distal
• Alliance: Lck^em1Ewyh page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Proline codon 440 (CCT) in exon 11 was changed to serine (TCT) (p.P440S) using an sgRNA (targeting CTGGGTAAGGGATTCGACCGTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is equivalent to the same human mutation associated with combined immunodeficiencies (CID). (J:342630)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Lck Mutation: 93 strains or lines available

References

• Original: J:342630 Lui VG, et al., A partial human LCK defect causes a T cell immunodeficiency with intestinal inflammation. J Exp Med. 2024 Jan 1;221(1)
• All: 1 reference(s)