Lckem1Ewyh
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Lckem1Ewyh |
| Name: |
lck proto-oncogene, Src family tyrosine kinase; endonuclease-mediated mutation 1, Elena W Y Hsieh |
| MGI ID: |
MGI:7565561 |
| Synonyms: |
LckP440S |
| Gene: |
Lck Location: Chr4:129442142-129467415 bp, - strand Genetic Position: Chr4, 63.26 cM, cytoband distal
|
| Alliance: |
Lckem1Ewyh page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Single point mutation
|
| |
|
Mutation details: Proline codon 440 (CCT) in exon 11 was changed to serine (TCT) (p.P440S) using an sgRNA (targeting CTGGGTAAGGGATTCGACCGTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is equivalent to the same human mutation associated with combined immunodeficiencies (CID).
(J:342630)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Lck Mutation: |
96 strains or lines available
|
|
| Original: |
J:342630 Lui VG, et al., A partial human LCK defect causes a T cell immunodeficiency with intestinal inflammation. J Exp Med. 2024 Jan 1;221(1) |
| All: |
1 reference(s) |
|