Ppp1r11^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ppp1r11^em1(IMPC)J
• Name: protein phosphatase 1, regulatory inhibitor subunit 11; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7548994
• Gene: Ppp1r11 Location: Chr17:37259248-37262633 bp, - strand Genetic Position: Chr17, 19.16 cM
• Alliance: Ppp1r11^em1(IMPC)J page
• IMPC: Ppp1r11 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTCTCTCTTGAATTCCTGG and GATTCATACTCTCCACAAAC, which resulted in a 599 bp deletion beginning at Chromosome 17 position 37,260,665 bp and ending after 37,261,263 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000267860 (exon 2) and 490 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 28 and early stop 83 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ppp1r11 Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)