About   Help   FAQ
Eprs1em1Foxp
Endonuclease-mediated Allele Detail
Summary
Symbol: Eprs1em1Foxp
Name: glutamyl-prolyl-tRNA synthetase 1; endonuclease-mediated mutation 1, Paul L Fox
MGI ID: MGI:7539575
Synonyms: Eprs1deltaZ
Gene: Eprs1  Location: Chr1:185095241-185160557 bp, + strand  Genetic Position: Chr1, 89.5 cM, cytoband H4-H6
Alliance: Eprs1em1Foxp page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Insertion
 
Mutation detailsExon 32 (last exon) was targeted with an sgRNA (targeting TTCAACCCTCTGTGTGAGCT) using CRISPR/Cas9 technology, resulting in the insertion/duplication of an A (GRCm39:chr1:185160256dup), which leads to a frameshift and premature stop codon (NM_001357474.1:c.4472dup:p.N1491Kfs*5). This mutation disrupts the ZBD domain in the encoded peptide. Transcription, splicing, transcript nuclear export and translation are normal, however, the expressed protein is highly unstable, with ~1/3 of the WT half-life. (J:339761)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Eprs1 Mutation:  81 strains or lines available
References
Original:  J:339761 Vasu K, et al., The zinc-binding domain of mammalian prolyl-tRNA synthetase is indispensable for catalytic activity and organism viability. iScience. 2021 Mar 19;24(3):102215
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory