Eprs1^em1Foxp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Eprs1^em1Foxp
• Name: glutamyl-prolyl-tRNA synthetase 1; endonuclease-mediated mutation 1, Paul L Fox
• MGI ID: MGI:7539575
• Synonyms: Eprs1^deltaZ
• Gene: Eprs1 Location: Chr1:185095241-185160557 bp, + strand Genetic Position: Chr1, 89.5 cM, cytoband H4-H6
• Alliance: Eprs1^em1Foxp page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Insertion
• Mutation details: Exon 32 (last exon) was targeted with an sgRNA (targeting TTCAACCCTCTGTGTGAGCT) using CRISPR/Cas9 technology, resulting in the insertion/duplication of an A (GRCm39:chr1:185160256dup), which leads to a frameshift and premature stop codon (NM_001357474.1:c.4472dup:p.N1491Kfs*5). This mutation disrupts the ZBD domain in the encoded peptide. Transcription, splicing, transcript nuclear export and translation are normal, however, the expressed protein is highly unstable, with ~1/3 of the WT half-life. (J:339761)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Eprs1 Mutation: 81 strains or lines available

References

• Original: J:339761 Vasu K, et al., The zinc-binding domain of mammalian prolyl-tRNA synthetase is indispensable for catalytic activity and organism viability. iScience. 2021 Mar 19;24(3):102215
• All: 1 reference(s)